The Swedish matsutake and the Japanese matsutake are the same species!

The market of matsutake is highly dependent on species affinity. To evaluate the relationship between Swedish and Japanese matsutake we used DNA-based identification. Sequence data in the rDNA gene subunit provide powerful information for the study of evolutionary relationships between taxa (Bruns et al. 1991). The high level of intraspecific variabillity in the internal transcribed spacer (ITS) makes it particulary useful when working at the species level (Bruns et al. 1991, Kårén et al. 1996). By studying the sequence of rDNA ITS, we wanted to investigate if Swedish and Japanese matsutake are conspecific.

Our DNA-sequencing of rDNA ITS of Swedish matsutake were sent to GenBank to be compared with 3 million sequences using the program BLASTN 2.0.8 (Altschul et al. 1997). Swedish matsutake had a 99 - 100% match with Japanese and Korean matsutake, based on more than 700 base pairs. The results from GenBank are visible below and published by Bergius & Danell (2000). The matchings below are hybrids between one of our Swedish sequences and Japanese or Korean sequences from Genbank. Our sequences are available at GenBank.

It is not surprising that Swedish and Japanese matsutake are conspecific (Kytövuori 1988) as the Eurasian taiga can be treated as a continuous coniferous forest, with no obvious gene flow barriers. Morphology, smell and taste are also identical. Apparently there are two names for the same species, so the nomenclature has to be clarified.

The first non Japanese scientist to mention the Japanese matsutake was the Swedish scientist Thunberg in 1784. The first documented report of matsutake in Sweden was made in 1849 in Halmbyboda near Uppsala by Fries (1854, 1857). He named it Agaricus focalis var. Goliath. The Swedish name "goliatmusseron" coined by Lundqvist & Persson (1987) is based on Fries' name. In fact Fries was probably the first to name the species today known as Tricholoma matsutake. No type specimen remains, but our opinion is that the specimen depicted in Fries' plates S0026 & S0027 (which are kept at the Swedish Museum of Natural History, Stockholm) clearly shows matsutake. This conclusion is in accordance with Lundell & Nannfeldt (1949). Our visit to Halmbyboda revealed a suitable matsutake habitat, but frost precluded a search for fruit bodies. According to the St. Louis Botanical Code where the oldest species name has priority, Blytt's nauseosum from 1905 should be selected. Ito & Imai's name matsutake is from 1925 and therefore younger. Goliath is a name of a variety, which does not have priority over the oldest species name, which is nauseosum. Due to the fact that the name T. matsutake is so commonly used, and since two different names may give the impression that there are two different species, we suggest that the name T. matsutake should be conserved. Therefore, in cooperation with Svengunnar Ryman at the Museum of Evolution, Uppsala University, we published a paper in the journal Taxon where we proposed that T. matsutake should be conserved under Art. 14 of the Botanical Code (Ryman et al. 2000). This proposal was accepted by the Committee for fungi (Gams 2002).

This investigation (Bergius & Danell 2000) was presented at a seminar at Department of Forest Botany, Tokyo University, in October 1999.

In this updated version, a map of the matsutake ITS region has been included, and the sequences are read as plus strands.

References:

Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.

Bergius, N. & Danell, E. (2000). The Swedish matsutake (Tricholoma nauseosum syn. T. matsutake): distribution, abundance and ecology. Scandinavian Journal of Forest Research 15: 318-325.

Blytt, A. 1905. Norges hymenomyceter. Videnskaps-Selsk. Skrifter 1. Math.-nat. Kl 1904 no. 6: 1-164. (In Norwegian).

Bruns, T. D., White, T. J. & Taylor, J.W. 1991. Fungal molecular systematics. Ann. Rev. Ecol. Syst. 22: 525-564

Fries, E. 1854. Monographia Armillarium Sueciae. Uppsala, Sweden p.5.

Fries, E. 1857. Monographia Hymenomycetum Sueciae, Vol I pp. 4-5. Uppsala, Sweden.

Gams, W. (2002). Report of the Committe for Fungi: 10. Taxon 51: 791-792.

Ito, S. & Imai, S. 1925. On the taxonomy of Shii-take and Matsu-take. Botanical Magazine. 34: 319-328.

Kårén, O., Högberg, N., Dahlberg, A., Jonsson, L. & Nylund, J-E. 1997. Inter- and intraspecific variation in the ITS region of rDNA of ectomyccorhizal fungi in Fennoscandia as detected by endonuclease analysis. New Phytol. 136: 313-325

Kytövuori, I. 1988. The Tricholoma caligatum group in Europe and North Africa. Karstenia 28: 65-77.

Lundell, S. & Nannfeldt, J. A. 1949. Fungi Exsiccati Suecici, Praesertim Upsaliensis. Fasc. 35-36. No. 1706. Uppsala, Sweden.

Lundqvist, N & Persson, O. 1987. Svenska svampnamn. SBT-förlaget, Stockholm, Sweden. ISBN 91-7810-716-4. (In Swedish).

Ryman, S., Bergius, N., Danell, E. (2000). Proposal to conserve the name Armillaria matsutake against Armillaria nauseosa (Fungi, Basidiomycotina, Tricholomataceae). Taxon 49: 555-556.

Thunberg, C-P. 1784. Flora Japonica, Uppsala, Sweden. p. 347.

BLASTN 2.0.8 [Jan-05-1999] The query sequence for this search has been filtered. Filtering eliminates low complexity regions that commonly give spuriously high scores that reflect compositional bias rather than significant position-by-position alignment. Filtering can eliminate these potentially confounding matches (e.g., hits against proline-rich regions or poly-A tails) from the blast reports, leaving regions whose blast statistics reflect the specificity of their pairwise alignment. Query= (777 letters) Searching..................................................done

If you have any problems or questions with the results of this search
please refer to the BLAST FAQs

Score E Sequences producing significant alignments: (bits) Value gb|U62964|TMU62964 Tricholoma matsutake internal transcribed sp... 1455 0.0 dbj|D86570|D86570 Tricholoma matsutake genes for 5.8S rRNA and ... 587 e-165 dbj|D85856|TM5ITS1B Tricholoma matsutake DNA for ITS1 488 e-135 dbj|D86100|TM5ITS2 Tricholoma matsutake ITS 2 486 e-135 dbj|D85746|TM51 Tricholoma matsutake mycelia DNA for ITS1 >gi|1... 480 e-133 dbj|D86572|D86572 Tricholoma caligatum genes for 5.8S rRNA and ... 480 e-133 gb|U62964|TMU62964 Tricholoma matsutake internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 25S ribosomal RNA gene, complete sequence Length = 4050 Score = 1455 bits (734), Expect = 0.0 Identities = 750/753 (99%), Gaps = 2/753 (0%) Strand = Plus / Plus Query: 14 ttgaataaagcttggttaggttgtcgctggctctccggggcatgtgcacgcctgacgcca 73 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 ttgaataaagcttggttaggttgtcgctggctctccggggcatgtgcacgcctgacgcca 60 Query: 74 atcttttcaccacctgtgcacattttgtaggcttggataaatatgtctcgaggaagctcg 133 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 atcttttcaccacctgtgcacattttgtaggcttggataaatatgtctcgaggaagctcg 120 Query: 134 gtttgaggactgccgtgctgcaaaagccaggctttccttgtatttttccagcctatgcat 193 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 gtttgaggactgccgtgctgcaaaagccaggctttccttgtatttttccagcctatgcat 180 Query: 194 tttattatacactcggtatgtcatggaatgttatttggttggcttaattgccagtaaacc 253 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 tttattatacactcggtatgtcatggaatgttatttggttggcttaattgccagtaaacc 240 Query: 254 ttatacaactttcaacaacggatctcttggctctcgcatcgatgaagaacgcagcgaaat 313 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 ttatacaactttcaacaacggatctcttggctctcgcatcgatgaagaacgcagcgaaat 300 Query: 314 gcgataagtaatgtgaattgcagaattcaagtgaatcatcgaatctttgaacgcaccttg 373 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 301 gcgataagtaatgtgaattgcagaattca-gtgaatcatcgaatctttgaacgcaccttg 359 Query: 374 cgctccttggtattccgaggagcatgcctgtttgagtgtcatgaaattctcnaccttttc 433 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 360 cgctccttggtattccgaggagcatgcctgtttgagtgtcatgaaattctcaaccttttc 419 Query: 434 agctttttgttgaataggcttggattttgggagttgttgcaggctgctcagaagtctgct 493 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 420 agctttttgttgaataggcttggattttgggagttgttgcaggctgctcagaagtctgct 479 Query: 494 ctccttaaatgtattagcggggcccttgttgtctagcatttggtgtgataattatctacg 553 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 480 ctccttaaatgtattagcggggcccttgttgtctagcatttggtgtgataattatctacg 539 Query: 554 ccattgtgaacaatgtaataggtcggcttctaatcgtctcgtaaagagacaatctctgac 613 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 540 ccattgtgaacaatgtaataggtcggcttctaatcgtctcgtaaagagacaatctctgac 599 Query: 614 attttgacctcaaatcaggtaggactacccgctgaacttaagcatatcaataagcggagg 673 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 600 attttgacctcaaatcaggtaggactacccgctgaacttaagcatatcaataagcggagg 659 Query: 674 aaaagaaactaacaaggattcccctag-aactgcgagtgaagcgggaaaagctcaaattt 732 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 660 aaaagaaactaacaaggattcccctagtaactgcgagtgaagcgggaaaagctcaaattt 719 Query: 733 aaaatctgatggtctttatggccttccgagttg 765 ||||||||||||||||||||||||||||||||| Sbjct: 720 aaaatctgatggtctttatggccttccgagttg 752 dbj|D86570|D86570 Tricholoma matsutake genes for 5.8S rRNA and 25S rRNA, partial sequences >gi|1480070|dbj|D86571|D86571 Tricholoma matsutake genes for 5.8S rRNA and 25S rRNA, partial sequences Length = 299 Score = 587 bits (296), Expect = e-165 Identities = 298/299 (99%) Strand = Plus / Plus Query: 345 tgaatcatcgaatctttgaacgcaccttgcgctccttggtattccgaggagcatgcctgt 404 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 tgaatcatcgaatctttgaacgcaccttgcgctccttggtattccgaggagcatgcctgt 60 Query: 405 ttgagtgtcatgaaattctcnaccttttcagctttttgttgaataggcttggattttggg 464 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 61 ttgagtgtcatgaaattctcaaccttttcagctttttgttgaataggcttggattttggg 120 Query: 465 agttgttgcaggctgctcagaagtctgctctccttaaatgtattagcggggcccttgttg 524 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 agttgttgcaggctgctcagaagtctgctctccttaaatgtattagcggggcccttgttg 180 Query: 525 tctagcatttggtgtgataattatctacgccattgtgaacaatgtaataggtcggcttct 584 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 tctagcatttggtgtgataattatctacgccattgtgaacaatgtaataggtcggcttct 240 Query: 585 aatcgtctcgtaaagagacaatctctgacattttgacctcaaatcaggtaggactaccc 643 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 aatcgtctcgtaaagagacaatctctgacattttgacctcaaatcaggtaggactaccc 299 dbj|D85856|TM5ITS1B Tricholoma matsutake DNA for ITS1 Length = 246 Score = 488 bits (246), Expect = e-135 Identities = 246/246 (100%) Strand = Plus / Plus Query: 14 ttgaataaagcttggttaggttgtcgctggctctccggggcatgtgcacgcctgacgcca 73 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 ttgaataaagcttggttaggttgtcgctggctctccggggcatgtgcacgcctgacgcca 60 Query: 74 atcttttcaccacctgtgcacattttgtaggcttggataaatatgtctcgaggaagctcg 133 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 atcttttcaccacctgtgcacattttgtaggcttggataaatatgtctcgaggaagctcg 120 Query: 134 gtttgaggactgccgtgctgcaaaagccaggctttccttgtatttttccagcctatgcat 193 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 gtttgaggactgccgtgctgcaaaagccaggctttccttgtatttttccagcctatgcat 180 Query: 194 tttattatacactcggtatgtcatggaatgttatttggttggcttaattgccagtaaacc 253 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 tttattatacactcggtatgtcatggaatgttatttggttggcttaattgccagtaaacc 240 Query: 254 ttatac 259 |||||| Sbjct: 241 ttatac 246 dbj|D86100|TM5ITS2 Tricholoma matsutake ITS 2 Length = 248 Score = 486 bits (245), Expect = e-135 Identities = 247/248 (99%) Strand = Plus / Plus Query: 407 gagtgtcatgaaattctcnaccttttcagctttttgttgaataggcttggattttgggag 466 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 gagtgtcatgaaattctcaaccttttcagctttttgttgaataggcttggattttgggag 60 Query: 467 ttgttgcaggctgctcagaagtctgctctccttaaatgtattagcggggcccttgttgtc 526 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 ttgttgcaggctgctcagaagtctgctctccttaaatgtattagcggggcccttgttgtc 120 Query: 527 tagcatttggtgtgataattatctacgccattgtgaacaatgtaataggtcggcttctaa 586 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 tagcatttggtgtgataattatctacgccattgtgaacaatgtaataggtcggcttctaa 180 Query: 587 tcgtctcgtaaagagacaatctctgacattttgacctcaaatcaggtaggactacccgct 646 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 tcgtctcgtaaagagacaatctctgacattttgacctcaaatcaggtaggactacccgct 240 Query: 647 gaacttaa 654 |||||||| Sbjct: 241 gaacttaa 248 dbj|D85746|TM51 Tricholoma matsutake mycelia DNA for ITS1 >gi|1389583|dbj|D85854|TM5ITS1 Tricholoma matsutake DNA for ITS1 Length = 246 Score = 480 bits (242), Expect = e-133 Identities = 245/246 (99%) Strand = Plus / Plus Query: 14 ttgaataaagcttggttaggttgtcgctggctctccggggcatgtgcacgcctgacgcca 73 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 ttgaataaagcttggttaggttgtcgctggctctccggggcatgtgcacgcctgacgcca 60 Query: 74 atcttttcaccacctgtgcacattttgtaggcttggataaatatgtctcgaggaagctcg 133 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 atcttttcaccacctgtgcacattttgtaggcttggataaatatgtctcgaggaagctcg 120 Query: 134 gtttgaggactgccgtgctgcaaaagccaggctttccttgtatttttccagcctatgcat 193 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 gtttgaggattgccgtgctgcaaaagccaggctttccttgtatttttccagcctatgcat 180 Query: 194 tttattatacactcggtatgtcatggaatgttatttggttggcttaattgccagtaaacc 253 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 tttattatacactcggtatgtcatggaatgttatttggttggcttaattgccagtaaacc 240 Query: 254 ttatac 259 |||||| Sbjct: 241 ttatac 246 dbj|D86572|D86572 Tricholoma caligatum genes for 5.8S rRNA and 25S rRNA, partial sequences Length = 303 Score = 480 bits (242), Expect = e-133 Identities = 293/305 (96%), Gaps = 8/305 (2%) Strand = Plus / Plus Query: 345 tgaatcatcgaatctttgaacgcaccttgcgct-ccttggtattccgaggagcatgcctg 403 ||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| Sbjct: 1 tgaatcatcgaatctttgaacgcaccttgcgcttccttggtattccnaggagcatgcctg 60 Query: 404 tttgagtgtcatgaaattc-tcnaccttttcagctttttgttgaataggcttggattttg 462 ||||||||||||| ||||| || ||||||||||||||| ||||||||||||||||||||| Sbjct: 61 tttgagtgtcatggaattcctcaaccttttcagctttt-gttgaataggcttggattttg 119 Query: 463 ggagttgttgcaggctgctcagaagtctgctctccttaaatgtattagcggggcccttgt 522 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | Sbjct: 120 ggagttgttgcaggctgctcagaagtctgctctccttaaatgtattagc-gggccctttt 178 Query: 523 tgtctagcatttggtgtgataattatctacgccattgtgaacaatgtaatagg----tcg 578 ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 179 tgtctagcatttggtgtgataattatctacgccattgtgaacaatgtaatagggagttcg 238 Query: 579 gcttctaatcgtctcgtaaagagacaatctctgacattttgacctcaaatcaggtaggac 638 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 239 gcttctaatcgtctcgtaaagagacaatctctgacattttgacctcaaatcaggtaggac 298 Query: 639 taccc 643 ||||| Sbjct: 299 taccc 303

The Swedish matsutake and the Japanese matsutake are the same species!

Map over the matsutake ITS-region as sequenced by Bergius & Danell (1999)